titi62 titi62
  • 12-01-2019
  • Mathematics
contestada

100, 119, 103, 111, 110, x, mean 116

Respuesta :

Аноним Аноним
  • 12-01-2019

Answer:


Step-by-step explanation:

100+119+103+111+110

/5

=108.6


Answer Link

Otras preguntas

5. This was the largest group of Native People on the coast when Europeans arrived a.The Inuit b.The Yakimac.The salishd.The okinogan ​
in a large population of cars, the mean number of miles driven is 62523 with a standard deviation of 34578. if you were to take many samples of size 10 from thi
A medicine ball has a mass of 8.0 kg and is thrown with a speed of 3.0 m/s. What is its kinetic energy? O A 12 J O B. 24 J C. 36 J 0 D. 192 J
The powers of the U.S. President were significantly limited by the decision in United States v. Nixon, in that it rejected which of President Richard Nixon’s cl
need mRNA AMINO ACIDS 1.AATACGGGGGCGTAACCACTA 2. GCTAGTACGTGCACATTAGAA
Please help me it's urgent
Answer any question of these
What will be the level of interest rate, i, if investment at 0 interest is $16 million and the coefficient of invest, I, equals 0.4.
(Please help! I this ASAP!) How did the delegates to the Constitution Convention settle the issue described above? A. The Virginia Plan B. The New Jersey Plan C
Find the area of this figure. A = in2