laurenblackbuen2005 laurenblackbuen2005

13-01-2020
Mathematics

contestada

Can two lines that have the same slope and Y intercept have no solution

Respuesta :

Hyper83 Hyper83

13-01-2020

No because they would always stay the same

Answer Link

Otras preguntas

A 120 V potential difference is applied to a space heater whose resistance is 11.5 Ω when hot. At what rate is electrical energy being transferred to thermal en

The petronas towers in Kuala Lumpur, Malaysia, are 1,483 feet tall. The key tower in Cleveland, Ohio, is 947 feet tall how is the difference in height between t

The mailing list of an agency that markets scuba-diving trips to the Florida Keys contains 78% males and 22% females. The agency calls 29 people chosen at rando

The Wall Street Journal reported that approximately 25% of the people who are told a product is improved will believe that it is, in fact, improved. The remaini

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of

Solve the equation 2x+8=12+10x

Suppose that you are the vice president of marketing for Target, the large retail store chain. You want to keep your website and in-store services current with

Before the Edict of Milan, Christian art ________________ a. could only be seen in the Christian Orthodox cathedrals. b. presented Christian stories through mul

Juan, the head of human resources at a large company, has been instructed to make sure that about 2% of all newly hired managers are women in order to reduce th

Of 400 college students, 120 are enrolled in math, 220 are enrolled in English, and 55 are enrolled in both. If a student is selected at random, what is the pro