josephdieuseul56 josephdieuseul56

11-04-2020
Geography

contestada

which of the following contribute the rise of the youth movement in 1960

Respuesta :

jackiecastro1222 jackiecastro1222

11-04-2020

Answer: increase in how much college costed kids did not want to conform and a lot of kids were from the baby boom generation

Explanation:

Answer Link

Otras preguntas

If you can answer all requirements I’ll give brainliest

2 1/3 × 3 1/2, giving your answer as a mixed number

During a certain epidemic, the number of people that are infected at any time increases at a rate proportional to the number of people that are infected at that

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

The DNA strand and pre-mRNA strand are anti-parallel. With this in mind label the 3' and 5' ends of the pre-mRNA strand in Model 1. Where would i put it??

how a positive personal life plan may promote meaningfulness of life

Helppp meee ill give branliest to who ever answers first correctly

what is , deposition,erosion AND weathering.

what is the best ingredient of a PB&J?

A gas occupies 56 L at 73°C. What volume will the gas occupy if the temp. cools to 0°C?