baabbylil15 baabbylil15

10-12-2020
History

contestada

In what areas of the world did the US gain influence as a resutt of the Spanish-American War?
O Europe and Asia
O the Arnericas and Africa
O Asia and the Americas
O Asia and Africa

Respuesta :

esandahl27 esandahl27

11-12-2020

Answer: Asia and Africa

Explanation :

Answer Link

Otras preguntas

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′?

A phone sells for $245. It is now on sale for 1/5 of the original price. April has a coupon for an extra 10% off sale price. How much less than the original pri

In a equation below, for what value of c does x=4? 1/2(2x+4)=3x-c

A woman with severe periodontal disease has a ___ times greater risk for a preterm infant with low birth weight compared with women with little or no periodonta

According to Lee, Padmanabhan and Wang, there are three underlying coordination mechanisms in a supply chain. Match the mechanism on the left with its definitio

Consider the following protocol for concurrency control. The database system assigns each transaction a unique and strictly increasingly id at the start of the

A tube, open at only one end, is cut into two shorter (nonequal) lengths. The piece that is open at both ends has a fundamental frequency of 416 Hz, while the p

Though she is opposed to capital punishment, Lisa is asked to give a speech in favor of it to round out a class debate. Dissonance theory predicts that her true

Which is the best way to tell your partner that you are not ready to be sexually intimate? 1.Say that you are worried about what your friends will think of you.

The branching pattern of a phylogenetic tree indicates whether taxa are closely or distantly related relative to other taxa in the tree. Use this phylogenetic t