jaysurya07 jaysurya07

11-01-2022
Biology

contestada

rhythemic contraction and relaxtion of heart is called _____.

Respuesta :

Аноним Аноним

11-01-2022

[tex]\huge \bf༆ Answer ༄[/tex]

Rhythmic contraction and relaxation of heart is called The Cardiac Cycle .

Answer Link

Otras preguntas

Which of the following is a substance that acts at a long distance from the site at which it is secreted? View Available Hint(s) A. hormone local regulator syna

Fructose‑2,6‑bisphosphate is a regulator of both glycolysis and gluconeogenesis for the phosphofructokinase reaction of glycolysis and the fructose‑1,6‑bisphosp

My teacher assigned this to me and its too hard

What value of p makes the equation true? 3/5p + 1/5 (40-p) = 0

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5 ′ − GGCCCUUUUAGGGCCAAAAA − 3 ′ a sequence of uracil–ade

What is the velocity of the car, in meters per second, just after it hits a 135-kg deer initially running at 10.5 m/s in the same direction? Assume the deer rem

which one goes with which

Please could someone help me ?

School-age children, as well as adults practicing a specific skill, may benefit from _______ as a teaching tool. a. diagrams b. printed handouts c. programme

Write 327,108 in word form