25roev05 25roev05

11-02-2022
Biology

contestada

What is the mRNA transcript if the complementary DNA is TCTGAG?

Respuesta :

10818570 10818570

11-02-2022

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

Answer Link

Otras preguntas

Carlos is walking on a moving walkway. His speed is given by the function C(x) = 3 x 2 + 3x - 4, and the speed of the walkway is W(x) = x 2 - 4x + 7. 20.

which word comes from a latin word meaning lattice

I really need help on geometry

What are some advantages of using less farm machinery in planting?

How would you describe the change in the arrangement of particles as heat energy and temperature increase?

There are 12 rabbits in a cage. The ratio of white rabbits to all rabbits is 3:4. How many white rabbits are in a cage?

Who was the 24 president of the United States?

In 8/100 what is the percent

I need an example of Alliteration in A Tale of Two Cities asap please

Most prokaryotes contain a single, circular DNA molecule. True or false ?