yahyaalwajeeh yahyaalwajeeh
  • 11-06-2022
  • Social Studies
contestada

Which of these species is NOT extinct?
dodo bird
scarlet macaw
passenger pigeon
tyrannosaurus rex

Respuesta :

litekolanchu
litekolanchu litekolanchu
  • 11-06-2022

Answer:

scarlet macaw

Explanation:

dodo bird, Tyrannosaurus rex and passenger pigeon are ALL extinct.

The scarlet macaw is a type of parrot is it? yes it is, I believe. It's still alive and breathing happily as to the dodo brid was extinct much earlier than the passenger pigeon and not too long after the T-Rex.

Hope this helps

Answer Link

Otras preguntas

1. It is the main energy provider in the process of food manufacture in the plant kingdom. *
Which of the following is NOT a linear function?
Given the following a=3,b=4, what is the length of side c? 5 6 4
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
necesito ayudaaaaa pls
Name the type of map 1.
what is 2 1/4 converted into an improper fraction
Introduction: Match each term or person on the left with the description on the right. John Wycliffe a priest who believed that only faith, not good works, coul
A man sells 5kg of rice at the cost price of 4kg of rice.Find the loss%
Billy went to the hardware store and bought 18 identical sections of pipe. The total length of the pipes was 45.18 meters. How long was each pipe?