tabip1298
tabip1298 tabip1298
  • 10-03-2017
  • Physics
contestada

What temperature is Sirius B?

Respuesta :

MonkeyLover123
MonkeyLover123 MonkeyLover123
  • 10-03-2017
The answer would be 9,940 K is the temperature of Sirius B.
Answer Link

Otras preguntas

What types of mental health resources do you think students should have access to at school, in order to help them through their challenges?
Which is the graph of the polar equation r = 4 cos3 theta
How do I answer this and I need explanation pls
You decide that you want to make a lighter purple paint. You make the new mixture by adding 1/4​​ cup of white paint for every 1/4​​ cup of red paint and 1/2​​
a letter to your friend describing how you found and save a missing child​
Here are some facts about units of length. Unit Symbol Fact inch foot ft 1 ft = 12 in yard yd 1 yd = 3 ft Fill in the blanks. 3 ft = in 8 yd =
On Christmas Eve I saw that my mother had outdone herself in creating a strange menu. What message does Amy Tan's description send? She feels that her mother is
How much force is needed to accelerate a 7.1 kg skier at 4 m/s/s?
Which function shows the function f(x) = 3^x being translated 5 units to the left? A. f(x) = 3^x – 5 B. f(x) = 3^(x+5) C. f(x) = 3^(x - 5) D. f(x) = 3^x + 5
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein